Lineage for d4ihvb_ (4ihv B:)

  1. Root: SCOPe 2.07
  2. 2299346Class a: All alpha proteins [46456] (289 folds)
  3. 2304501Fold a.4: DNA/RNA-binding 3-helical bundle [46688] (14 superfamilies)
    core: 3-helices; bundle, closed or partly opened, right-handed twist; up-and down
  4. 2304502Superfamily a.4.1: Homeodomain-like [46689] (20 families) (S)
    consists only of helices
  5. 2305254Family a.4.1.12: FIS-like [100918] (4 protein domains)
  6. 2305259Protein FIS protein [48285] (2 species)
    includes N-terminal dimerisation subdomain
  7. 2305260Species Escherichia coli K-12 [TaxId:83333] [226820] (15 PDB entries)
  8. 2305261Domain d4ihvb_: 4ihv B: [223177]
    automated match to d3iv5b_
    protein/DNA complex

Details for d4ihvb_

PDB Entry: 4ihv (more details), 2.72 Å

PDB Description: crystal structure of fis bound to 27 bp sequence dna f28 (aaatttgtttgagcgttgagcaaattt)
PDB Compounds: (B:) DNA-binding protein fis

SCOPe Domain Sequences for d4ihvb_:

Sequence; same for both SEQRES and ATOM records: (download)

>d4ihvb_ a.4.1.12 (B:) FIS protein {Escherichia coli K-12 [TaxId: 83333]}

SCOPe Domain Coordinates for d4ihvb_:

Click to download the PDB-style file with coordinates for d4ihvb_.
(The format of our PDB-style files is described here.)

Timeline for d4ihvb_:

View in 3D
Domains from other chains:
(mouse over for more information)