Lineage for d4ihva_ (4ihv A:)

  1. Root: SCOPe 2.06
  2. 1976409Class a: All alpha proteins [46456] (289 folds)
  3. 1981147Fold a.4: DNA/RNA-binding 3-helical bundle [46688] (14 superfamilies)
    core: 3-helices; bundle, closed or partly opened, right-handed twist; up-and down
  4. 1981148Superfamily a.4.1: Homeodomain-like [46689] (20 families) (S)
    consists only of helices
  5. 1981873Family a.4.1.12: FIS-like [100918] (4 protein domains)
  6. 1981878Protein FIS protein [48285] (2 species)
    includes N-terminal dimerisation subdomain
  7. 1981906Species Escherichia coli [TaxId:562] [48286] (16 PDB entries)
  8. 1981929Domain d4ihva_: 4ihv A: [223176]
    automated match to d1etyb_
    protein/DNA complex

Details for d4ihva_

PDB Entry: 4ihv (more details), 2.72 Å

PDB Description: crystal structure of fis bound to 27 bp sequence dna f28 (aaatttgtttgagcgttgagcaaattt)
PDB Compounds: (A:) DNA-binding protein fis

SCOPe Domain Sequences for d4ihva_:

Sequence; same for both SEQRES and ATOM records: (download)

>d4ihva_ a.4.1.12 (A:) FIS protein {Escherichia coli [TaxId: 562]}

SCOPe Domain Coordinates for d4ihva_:

Click to download the PDB-style file with coordinates for d4ihva_.
(The format of our PDB-style files is described here.)

Timeline for d4ihva_:

View in 3D
Domains from other chains:
(mouse over for more information)