PDB entry 1kx4

View 1kx4 on RCSB PDB site
Description: X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution
Class: structural protein/DNA
Keywords: nucleosome, chromatin, histone, protein-DNA interaction, nucleoprotein, supercoiled DNA, nucleosome core, protein-DNA complex, structural protein/DNA complex
Deposited on 2002-01-31, released 2002-12-25
The last revision prior to the SCOPe 2.07 freeze date was dated 2009-02-24, with a file datestamp of 2009-03-01.
Experiment type: XRAY
Resolution: 2.6 Å
R-factor: 0.246
AEROSPACI score: 0.26 (click here for full SPACI score report)

Chains and heterogens:

  • Chain 'A':
    Compound: histone h3
    Species: Xenopus laevis [TaxId:8355]
    Database cross-references and differences (RAF-indexed):
    • Uniprot P16105 (Start-134)
      • conflict (101)
    Domains in SCOPe 2.07: d1kx4a_
  • Chain 'B':
    Compound: histone h4
    Species: Xenopus laevis [TaxId:8355]
    Database cross-references and differences (RAF-indexed): Domains in SCOPe 2.07: d1kx4b_
  • Chain 'C':
    Compound: histone h2a.1
    Species: Xenopus laevis [TaxId:8355]
    Database cross-references and differences (RAF-indexed): Domains in SCOPe 2.07: d1kx4c_
  • Chain 'D':
    Compound: histone h2b.2
    Species: Xenopus laevis [TaxId:8355]
    Database cross-references and differences (RAF-indexed):
    • Uniprot P02281 (Start-124)
      • variant (31)
    Domains in SCOPe 2.07: d1kx4d_
  • Chain 'E':
    Compound: histone h3
    Species: Xenopus laevis [TaxId:8355]
    Database cross-references and differences (RAF-indexed):
    • Uniprot P16105 (Start-134)
      • conflict (101)
    Domains in SCOPe 2.07: d1kx4e_
  • Chain 'F':
    Compound: histone h4
    Species: Xenopus laevis [TaxId:8355]
    Database cross-references and differences (RAF-indexed): Domains in SCOPe 2.07: d1kx4f_
  • Chain 'G':
    Compound: histone h2a.1
    Species: Xenopus laevis [TaxId:8355]
    Database cross-references and differences (RAF-indexed): Domains in SCOPe 2.07: d1kx4g_
  • Chain 'H':
    Compound: histone h2b.2
    Species: Xenopus laevis [TaxId:8355]
    Database cross-references and differences (RAF-indexed):
    • Uniprot P02281 (Start-124)
      • variant (31)
    Domains in SCOPe 2.07: d1kx4h_
  • Chain 'I':
    Compound: DNA (5'(atctccaaatatcccttgcggatcgtagaaaaagtgtgtcaaactgcgctatcaaagggaaacttcaactgaattcagttgaagtttccctttgatagcgcagtttgacacactttttctacgatccgcaagggatatttggagat)3')
    Species: Homo sapiens [TaxId:9606]
  • Chain 'J':
    Compound: DNA (5'(atctccaaatatcccttgcggatcgtagaaaaagtgtgtcaaactgcgctatcaaagggaaacttcaactgaattcagttgaagtttccctttgatagcgcagtttgacacactttttctacgatccgcaagggatatttggagat)3')
    Species: Homo sapiens [TaxId:9606]
  • Heterogens: MN, CL, HOH

PDB Chain Sequences:

  • Chain 'A':
    Sequence, based on SEQRES records: (download)
    >1kx4A (A:)

    Sequence, based on observed residues (ATOM records): (download)
    >1kx4A (A:)

  • Chain 'B':
    Sequence, based on SEQRES records: (download)
    >1kx4B (B:)

    Sequence, based on observed residues (ATOM records): (download)
    >1kx4B (B:)

  • Chain 'C':
    Sequence, based on SEQRES records: (download)
    >1kx4C (C:)

    Sequence, based on observed residues (ATOM records): (download)
    >1kx4C (C:)

  • Chain 'D':
    Sequence, based on SEQRES records: (download)
    >1kx4D (D:)

    Sequence, based on observed residues (ATOM records): (download)
    >1kx4D (D:)

  • Chain 'E':
    Sequence, based on SEQRES records: (download)
    >1kx4E (E:)

    Sequence, based on observed residues (ATOM records): (download)
    >1kx4E (E:)

  • Chain 'F':
    Sequence, based on SEQRES records: (download)
    >1kx4F (F:)

    Sequence, based on observed residues (ATOM records): (download)
    >1kx4F (F:)

  • Chain 'G':
    Sequence, based on SEQRES records: (download)
    >1kx4G (G:)

    Sequence, based on observed residues (ATOM records): (download)
    >1kx4G (G:)

  • Chain 'H':
    Sequence, based on SEQRES records: (download)
    >1kx4H (H:)

    Sequence, based on observed residues (ATOM records): (download)
    >1kx4H (H:)

  • Chain 'I':
    No sequence available.

  • Chain 'J':
    No sequence available.