PDB entry 1fg0

View 1fg0 on RCSB PDB site
Description: large ribosomal subunit complexed with a 13 bp minihelix-puromycin compound
Deposited on 2000-07-26, released 2000-08-28
The last revision was dated 2009-02-24, with a file datestamp of 2009-02-03.
Experiment type: XRAY
Resolution: 3 Å
R-factor: N/A
AEROSPACI score: 0.08 (click here for full SPACI score report)

Chains and heterogens:

  • Chain 'A':
    Compound: 23S ribosomal RNA
    Species: Haloarcula marismortui [TaxId:2238]
  • Chain 'B':
    Compound: 5'-r(ccggcgggcugguucaaaccggcccgccggacc)-3'-5'-r(p-puromycin)-3'

PDB Chain Sequences:
This PDB entry is not classified in SCOPe 2.08, so the chain sequences below are not included in the ASTRAL sequence sets.

  • Chain 'A':
    No sequence available.

  • Chain 'B':
    No sequence available.