PDB entry 1fg0
View 1fg0 on RCSB PDB site
Description: large ribosomal subunit complexed with a 13 bp minihelix-puromycin compound
Deposited on
2000-07-26, released
2000-08-28
The last revision was dated
2009-02-24, with a file datestamp of
2009-02-03.
Experiment type: XRAY
Resolution: 3 Å
R-factor: N/A
AEROSPACI score: 0.08
(click here for full SPACI score report)
Chains and heterogens:
- Chain 'A':
Compound: 23S ribosomal RNA
Species: Haloarcula marismortui [TaxId:2238]
- Chain 'B':
Compound: 5'-r(ccggcgggcugguucaaaccggcccgccggacc)-3'-5'-r(p-puromycin)-3'
PDB Chain Sequences:
This PDB entry is not classified in SCOPe 2.08, so the chain sequences below are not included in the ASTRAL sequence sets.
- Chain 'A':
No sequence available.
- Chain 'B':
No sequence available.